T61 Primer Detail MGI Mouse MGI:611

T61 Primer Detail

Name

T61
Primer 1 Sequence

AGCAGGGCTACACAGAGAAAC
Primer 2 Sequence

ATTCCCATATTTGCATCTCCA
ID

MGI:611

Afp	alpha fetoprotein
D5Nds4	DNA segment, Chr 5, Nuffield Department of Surgery 4

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D5Nds4	d	97bp	BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac
	e	90bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	f	85bp	CAST/EiJ, LP/J
	i	86bp	NOD/ShiLt

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D5Nds4	a	smaller	AKR/J, C57BL/J
	l	larger	LG/J
	s	smallest	SM/J

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24