114.MMMPO Primer Detail MGI Mouse MGI:6232

114.MMMPO Primer Detail

Name

114.MMMPO
Primer 1 Sequence

GTGAGTTCTAGGACAGCCAGG
Primer 2 Sequence

ACAACCACTTCTTCACCCATGG
ID

MGI:6232
Product Size

215bp
Synonyms

114MMPO, MMMPO

Mpo

myeloperoxidase

J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both. The product size of 279bp reported here varies somewhat from the size reported in other references.

Endonuclease	Gene	Allele	Fragments	Strains
	Mpo	a	largest	AKR/J, DBA/2J, NOD, NON
	Mpo	b	2nd largest	B6.PL-Thy1^a, C57BL/6J, C57BL/10-H2^g7, SPR

J:462 Montagutelli X, et al., Mamm Genome. 1991;1(4):255-9

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282.

Gene	Allele	Fragments	Strains
Mpo	a	largest	129S2/SvPas, BALB/cPas, C3H/HePas, DBA/2Pas, STS/Pas
	b	2nd largest	C57BL/6Pas, PWK/Pas, SPR/Smh
	c	3rd largest	SEG/Pas, SPE/Pas
	d	4th largest	DDK/Pas

J:1084 Fowlis GA, et al., Mamm Genome. 1992;3(4):192-6

Gene	Allele	Fragments	Strains
Mpo	a	largest	A/JCrc, AKR/Nimr, BALB/cCrc, C3H/HeCrc, CBA/CaCrc, NOD/Crc
	b	larger	NZW/Ola
	c	smaller	B10.D2-H2^d/Nimr, C57L/J

J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82

J:462 Montagutelli X, et al., PCR-analyzed microsatellites: data concerning laboratory and wild-derived mouse inbred strains. Mamm Genome. 1991;1(4):255-9

J:1084 Fowlis GA, et al., PCR-analyzed microsatellites of the mouse genome--additional polymorphisms among ten inbred mouse strains. Mamm Genome. 1992;3(4):192-6

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24