72MMANF Primer Detail MGI Mouse MGI:6332

72MMANF Primer Detail

Name

72MMANF
Primer 1 Sequence

AGAATAAACTTCAGCACCAAG
Primer 2 Sequence

ATTTTGAGGACTATGACGTGA
ID

MGI:6332
Product Size

172bp
Synonyms

72.MMANF

Nppa

natriuretic peptide type A

J:459 Hearne CM, et al., Mamm Genome. 1991;1(4):273-82

Notes: Sequences named according to Love et al (1990), Nucl Acids Res 18:4123-4130, and Hearne et al (1991), Mammalian Genome 1:273-282. Some alleles are resolvable on acrylamide, some are resolvable on 4% agarose, other alleles are resolvable by both.

Endonuclease	Gene	Allele	Fragments	Strains
	Nppa	a	present	B6.PL-Thy1^a, C57BL/6J, C57BL/10-H2^g7, SPR
	Nppa	b	absent	NOD, NON

J:20039 Fiedorek FT Jr, et al., Mamm Genome. 1994 Aug;5(8):479-85

Notes: Electrophoretic variants distinguishing the two strains were identified using single stranded conformation polymorphic analysis.

Endonuclease	Gene	Allele	Fragments	Strains
	Nppa	b	not given	BKS.D-Dock7^m
	Nppa	c	not given	CZECHII

J:459 Hearne CM, et al., Additional microsatellite markers for mouse genome mapping. Mamm Genome. 1991;1(4):273-82

J:20039 Fiedorek FT Jr, et al., Mapping of PCR-based markers for mouse chromosome 4 on a backcross penetrant for the misty (m) mutation. Mamm Genome. 1994 Aug;5(8):479-85

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24