T28 Primer Detail MGI Mouse MGI:636

T28 Primer Detail

Name

T28
Primer 1 Sequence

CAGACTTTCATTTCTTTGGATAC
Primer 2 Sequence

ATGCCATCATGTGTTGAAGCA
ID

MGI:636
Product Size

115bp
Synonyms

TJ-2.7

D7Nds2

DNA segment, Chr 7, Nuffield Department of Surgery 2

J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81

Gene	Allele	Fragments	Strains
D7Nds2	d	smaller	DBA/2J
	h	largest	AKR/J, B6.PL-Thy1^a/SnJ, C57BL/6J, C57BL/10-H2^g7
	n	larger	NOD, NON
	s	smallest	M. spretus

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D7Nds2	a	116bp	A/J
	d	112bp	C3H/HeJ, DBA/2J
	e	118bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	114bp	CAST/EiJ, LP/J, NOD/MrkTac, NON/ShiLt
	g	119bp	AKR/J, BALB/cJ
	s	97bp	SPRET/EiJ

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D7Nds2	a	larger	AKR/J, C57BL/J
	l	smallest	LG/J
	s	smaller	SM/J

J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Nds2	a	108bp	129T1/Sv-Dnd1^Ter, 129X1/Sv, C3HeB/FeJ
		c	124bp	129P1/ReJ, 129P2/Ola, 129P3/J, 129P4/RrRkJ, 129X1/SvJ
		d	112bp	C57BL/6J

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Nds2	a	108bp	129X1/Sv
Not Specified	D7Nds2	b	110, 124bp	CD-1

J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13