T63 Primer Detail MGI Mouse MGI:637

T63 Primer Detail

Name

T63
Primer 1 Sequence

GTGACAATACATTCCTGCTGT
Primer 2 Sequence

CTCAGATCTTATCTCTAGCAC
ID

MGI:637
Product Size

~200bp

D7Nds4	DNA segment, Chr 7, Nuffield Department of Surgery 4
Fgf3	fibroblast growth factor 3

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D7Nds4	b	166bp	AKR/J, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	160bp	A/J, C3H/HeJ, DBA/2J, LP/J
	e	168bp	B6.Cg-Lep^ob/+
	f	145bp	CAST/EiJ
	s	175bp	SPRET/EiJ

J:18181 Ord DC, et al., Immunogenetics. 1994;39(5):322-8

Endonuclease	Gene	Allele	Fragments	Strains
	Fgf3	b	not given	C57BL/6J
	Fgf3	s	not given	M. spretus

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Endonuclease	Gene	Allele	Fragments	Strains
	D7Nds4	a	larger	AKR/J, C57BL/J, LG/J
	D7Nds4	s	smaller	SM/J

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Nds4	a	160bp	129X1/Sv
Not Specified	D7Nds4	f	164, 170bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D7Nds4	c	160bp	C3HeB/FeJLe
	D7Nds4	f	larger	FVB/N

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Nds4	a	largest	JF1
		b	smaller	MSM/Ms
		c	smallest	C57BL/6, DBA/2

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:18181 Ord DC, et al., CD19 maps to a region of conservation between human chromosome 16 and mouse chromosome 7. Immunogenetics. 1994;39(5):322-8

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24