Afp-pM1, Afp-pN1 Primer Detail MGI Mouse MGI:6382619

About Help FAQ

Afp-pM1, Afp-pN1 Primer Detail

Name

Afp-pM1, Afp-pN1
Primer 1 Sequence

CACTGCTGCAACTCTTCGTA
Primer 2 Sequence

CTTTGGACCCTCTTCTGTGA
ID

MGI:6382619

Afp

alpha fetoprotein

Assay Results

19

J:103404 Tan EH, et al., CCAAT/enhancer binding protein alpha knock-in mice exhibit early liver glycogen storage and reduced susceptibility to hepatocellular carcinoma. Cancer Res. 2005 Nov 15;65(22):10330-7

J:152099 Bi Y, et al., Wnt antagonist SFRP3 inhibits the differentiation of mouse hepatic progenitor cells. J Cell Biochem. 2009 Jun 26;108(1):295-303

J:159513 Huang J, et al., Retinoic acid signalling induces the differentiation of mouse fetal liver-derived hepatic progenitor cells. Liver Int. 2009 Nov;29(10):1569-81

J:316295 Ochiai W, et al., Role of the Drug-Metabolizing Enzyme CYP during Mouse Liver Development. Biol Pharm Bull. 2016;39(12):2015-2021

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13