D7Ucl1-pA, D7Ucl1-pB Primer Detail MGI Mouse MGI:6461

About Help FAQ

D7Ucl1-pA, D7Ucl1-pB Primer Detail

Name

D7Ucl1-pA, D7Ucl1-pB
Primer 1 Sequence

AGGTCTGTCATCTGAGGAAC
Primer 2 Sequence

TGTAAACTGCCATGTGCTGG
ID

MGI:6461
Product Size

370bp

D7Ucl1

DNA segment, Chr 7, University College London 1

J:26240 Malas S, et al., Mouse Genome. 1995;93(2):433-5

Endonuclease	Gene	Allele	Fragments	Strains
	D7Ucl1	b	larger	C57BL/6J
	D7Ucl1	s	smaller	M. spretus

J:26240 Malas S, et al., PCR Markers associated with the mouse nicotinic-acetylcholine-receptor-subunit genes alpha-4, alpha-7 and beta-4 on mouse Chromosomes 2, 7, and 9. Mouse Genome. 1995;93(2):433-5

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24