About   Help   FAQ
INPCA1-pA, INPCA1-pB Primer Detail
Primers
  • Name
    INPCA1-pA, INPCA1-pB
  • Primer 1 Sequence
    TGCAGTGCACATACACATATGC
  • Primer 2 Sequence
    ACTGCCTTAGGTGTTGTTCCA
  • ID
    MGI:6478
  • Synonyms
    Inpp5b-pA, Inpp5b-pB
Genes
Inpp5b inositol polyphosphate-5-phosphatase B
Polymorphisms
J:28020 Janne PA, et al., Genomics. 1995 Jul 20;28(2):280-5
Endonuclease Gene Allele Fragments Strains
Inpp5b a 0.144kb BALB/cHeA-Foxe3dyl/J, BALB/cJ
b 0.134kb C57BL/6J
c 0.148kb SJL/J
d 0.146kb DBA/2J
e 0.144kb 129X1/SvJ
f 0.132kb CAST/EiJ
g 0.136kb M. spretus
References
J:28020 Janne PA, et al., Mapping of the 75-kDa inositol polyphosphate-5-phosphatase (Inpp5b) to distal mouse chromosome 4 and its exclusion as a candidate gene for dysgenetic lens. Genomics. 1995 Jul 20;28(2):280-5
J:68340 Maeda YY, et al., Two interactive genes responsible for a new inherited cataract (RCT) in the mouse. Mamm Genome. 2001 Apr;12(4):278-83

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory