D17Aus16-pA, D17Aus16-pB Primer Detail MGI Mouse MGI:6483

About Help FAQ

D17Aus16-pA, D17Aus16-pB Primer Detail

Name

D17Aus16-pA, D17Aus16-pB
Primer 1 Sequence

TATGGTGCACTCTCAGTACT
Primer 2 Sequence

ATTGAGGCAGGTTGAGTGAT
ID

MGI:6483
Product Size

130bp

D17Aus16

DNA segment, Chr 17, Austin 16

J:847 Ebersole T, et al., Genetics. 1992 May;131(1):175-82

Notes: Strain and t haplotype designations appear in the allele groupings.

Endonuclease	Gene	Allele	Fragments	Strains
	D17Aus16	a	smaller	C3H
	D17Aus16	b	larger	STOCK T

J:847 Ebersole T, et al., New molecular markers for the distal end of the t-complex and their relationships to mutations affecting mouse development. Genetics. 1992 May;131(1):175-82

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13