D11Nds14-pA, D11Nds14-pB Primer Detail MGI Mouse MGI:6529

About Help FAQ

D11Nds14-pA, D11Nds14-pB Primer Detail

Name

D11Nds14-pA, D11Nds14-pB
Primer 1 Sequence

AGCTTTGGAGACAACAATTAGATC
Primer 2 Sequence

TGTTCATCAGCTGAGGAATGGATG
ID

MGI:6529
Note

Primer sequence obtained via Nuffield Department of Surgery website https://www-gene.cimr.cam.ac.uk/todd/public_data/mouse/NDS/

D11Nds14

DNA segment, Chr 11, Nuffield Department of Surgery 14

J:28719 Lord CJ, et al., Mamm Genome. 1995 Sep;6(9):563-70

Endonuclease	Gene	Allele	Fragments	Strains
	D11Nds14	b	105bp	B6.PL-Thy1^a/CyJ
	D11Nds14	n	119bp	NOD/MrkTac

J:28719 Lord CJ, et al., Mapping the diabetes polygene Idd3 on mouse chromosome 3 by use of novel congenic strains. Mamm Genome. 1995 Sep;6(9):563-70

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/03/2024 MGI 6.24