Atp1b2-pA, Atp1b2-pB Primer Detail MGI Mouse MGI:6542

Atp1b2-pA, Atp1b2-pB Primer Detail

Name

Atp1b2-pA, Atp1b2-pB
Primer 1 Sequence

TGGTGTTCCTGCCACAGAAA
Primer 2 Sequence

TCTGAAGACAGCTACAGTGT
ID

MGI:6542

Atp1b2

ATPase, Na+/K+ transporting, beta 2 polypeptide

J:29702 Santos J, et al., Cytogenet Cell Genet. 1995;71(3):223-4

Gene	Allele	Fragments	Strains
Atp1b2	a	148bp	CAST/EiJ
	b	166bp	C57BL/6J, M. m. domesticus
	c	154bp	CZECHII
	m	138bp	MOLF/EiJ
	r	160bp	RF/J
	s	142bp	SPRET/EiJ

J:31797 Santos J, et al., Oncogene. 1996 Feb 1;12(3):669-76

Endonuclease	Gene	Allele	Fragments	Strains
	Atp1b2	b	larger	C57BL/6J
	Atp1b2	r	smaller	RF/J

J:29702 Santos J, et al., Eight new polymorphic microsatellites in mouse gene loci. Cytogenet Cell Genet. 1995;71(3):223-4

J:31797 Santos J, et al., Allelic losses on chromosome 4 suggest the existence of a candidate tumor suppressor gene region of about 0.6 cM in gamma-radiation-induced mouse primary thymic lymphomas. Oncogene. 1996 Feb 1;12(3):669-76

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24