D6Rck330-pA, D6Rck330-pB Primer Detail MGI Mouse MGI:6633

About Help FAQ

D6Rck330-pA, D6Rck330-pB Primer Detail

Name

D6Rck330-pA, D6Rck330-pB
Primer 1 Sequence

GTTCCCTAAGCCCTAGGTGG
Primer 2 Sequence

TAGGCCATAGTCTTTGGGGA
ID

MGI:6633
Product Size

178bp

D6Rck330

DNA segment, Chr 6, Rockefeller University 330

J:30546 Zuo J, et al., Genome Res. 1995 Nov;5(4):381-92

Endonuclease	Gene	Allele	Fragments	Strains
	D6Rck330	b	176bp	C57BL/6J
	D6Rck330	c	240bp	CAST/EiJ, SPRET/EiJ

J:30546 Zuo J, et al., Generation of a high-resolution genetic map and a YAC contig of the Lurcher locus on mouse chromosome 6. Genome Res. 1995 Nov;5(4):381-92

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13