About   Help   FAQ
TJ-T1 Primer Detail
Primers
  • Name
    TJ-T1
  • Primer 1 Sequence
    AGTGATGTGATTACAGGTTTG
  • Primer 2 Sequence
    CACTCTATAAACCCACTGCAG
  • ID
    MGI:671
  • Product Size
    90bp
  • Synonyms
    T51
Genes
D12Nds1 DNA segment, Chr 12, Nuffield Department of Surgery 1
Polymorphisms
J:11484 Cornall RJ, et al., Genomics. 1991 Aug;10(4):874-81
Endonuclease Gene Allele Fragments Strains
D12Nds1 n larger C57BL/6J, C57BL/10-H2g7, DBA/2J, NOD
o smaller M. spretus, NON
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D12Nds1 e 93bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
f 112bp CAST/EiJ
J:12925 Wallin J, et al., Mamm Genome. 1993;4(7):354-8
Endonuclease Gene Allele Fragments Strains
D12Nds1 b 93bp C57BL/6
m 67bp MSM/Ms
J:22176 Watanabe T, et al., Mamm Genome. 1994 Dec;5(12):768-70
Endonuclease Gene Allele Fragments Strains
D12Nds1 b 90bp C57BL/6
s 72bp M. spretus/Crc
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D12Nds1 a larger AKR/J, C57BL/J, LG/J
s smaller SM/J
References
J:11484 Cornall RJ, et al., The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics. 1991 Aug;10(4):874-81
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:12925 Wallin J, et al., A new Pax gene, Pax-9, maps to mouse chromosome 12. Mamm Genome. 1993;4(7):354-8
J:22176 Watanabe T, et al., Fine genetic mapping defines the genetic order of Pax9, Tcf3a, and Acrodysplasia (Adp). Mamm Genome. 1994 Dec;5(12):768-70
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory