R75 Primer Detail MGI Mouse MGI:7

R75 Primer Detail

Name

R75
Primer 1 Sequence

CTAGTCCGACCAGCGTCAC
Primer 2 Sequence

GTACCCCAATCCTGAACCAC
ID

MGI:7
Product Size

155bp

D15Kyo1	DNA segment, Chr 15, Kyoto University 1
Myc	myelocytomatosis oncogene

J:15206 Kondo Y, et al., Mamm Genome. 1993;4(10):571-6

Gene	Allele	Fragments	Strains
D15Kyo1	a	larger	A/J, AKR/J, C57BL/6J, DBA/2J
	p	smallest	PWK/Pas
	s	smaller	C57L/J, SEG/Pas, SPE/Pas
Myc	a	larger	A/J, AKR/J, C57BL/6J, DBA/2J
	p	smallest	PWK/Pas
	s	smaller	C57L/J, SEG/Pas, SPE/Pas

J:15206 Kondo Y, et al., DNA segments mapped by reciprocal use of microsatellite primers between mouse and rat. Mamm Genome. 1993;4(10):571-6

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:329537 Martinez Traverso IM, et al., LATS1/2 control TGFB-directed epithelial-to-mesenchymal transition in the murine dorsal cranial neuroepithelium through YAP regulation. Development. 2022 Sep 15;149(18):dev200860

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24