D2Mit1 Primer Detail MGI Mouse MGI:700216

D2Mit1 Primer Detail

Name

D2Mit1
Primer 1 Sequence

CTTTTTCGTATGTGGTGGGG
Primer 2 Sequence

AACATTGGGCCTCTATGCAC
ID

MGI:700216
Product Size

123
Other IDs

D2Mit1 (BROAD)
Note

MIT assay: M128
Additional information: MIT STS Marker Data Files

D2Mit1

DNA segment, Chr 2, Massachusetts Institute of Technology 1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D2Mit1	b	larger	C57BL/6J
	c	120bp	C3HeB/FeJLe
	f	largest	FVB/N

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D2Mit1	a	largest	JF1
		b	smaller	MSM/Ms
		c	smallest	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit1	a	96bp	SPRET/EiJ
	b	120bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	124bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	d	140bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit1	l	larger	LG/J
	D2Mit1	s	smaller	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit1	a	124bp	C57BL/6W
	D2Mit1	b	120bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, C57BL/10W, CBA/W, DBA/2W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24