D4Mit19 Primer Detail MGI Mouse MGI:700232

D4Mit19 Primer Detail

Name

D4Mit19
Primer 1 Sequence

ACAGATGTGCATGATATCATTTCC
Primer 2 Sequence

GCAGGCTTCATTCCTAGCC
ID

MGI:700232
Product Size

203
Other IDs

D4Mit19 (BROAD)
Note

MIT assay: A1129
Additional information: MIT STS Marker Data Files

D4Mit19

DNA segment, Chr 4, Massachusetts Institute of Technology 19

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D4Mit19	m	206bp	MOLF/EiJ
Not Specified	D4Mit19	s	212bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit19	a	206bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	212bp	CAST/EiJ
	c	216bp	SPRET/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24