D11Mit30 Primer Detail MGI Mouse MGI:700265

D11Mit30 Primer Detail

Name

D11Mit30
Primer 1 Sequence

GCTGCTGAACAAGTAGGGTC
Primer 2 Sequence

CCGTCATTGCTAAAGGGAAG
ID

MGI:700265
Product Size

40
Other IDs

D11Mit30 (BROAD)
Note

MIT assay: D503
Additional information: MIT STS Marker Data Files

D11Mit30

DNA segment, Chr 11, Massachusetts Institute of Technology 30

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit30	b	smaller	C57BL/6J
	D11Mit30	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit30	a	172bp	CAST/EiJ, DBA/2J
	b	180bp	SPRET/EiJ
	c	182bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	188bp	A/J, BALB/cJ, LP/J, NOD/MrkTac
	e	190bp	NON/ShiLt
	f	194bp	AKR/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24