D7Mit118 Primer Detail MGI Mouse MGI:700301

D7Mit118 Primer Detail

Name

D7Mit118
Primer 1 Sequence

ATATCCTAAAGAACATTAATGTCCAGA
Primer 2 Sequence

TGAGCATTCTCTGTTTAGATCTGC
ID

MGI:700301
Product Size

143
Other IDs

D7Mit118 (BROAD)
Note

MIT assay: MPC2467
Additional information: MIT STS Marker Data Files

D7Mit118a	DNA segment, Chr 7, Massachusetts Institute of Technology 118a
D7Mit118b	DNA segment, Chr 7, Massachusetts Institute of Technology 118b

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit118a	m	187bp	MOLF/EiJ
Not Specified	D7Mit118a	s	162bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit118a	a	126bp	B6.Cg-Lep^ob/+
	b	146bp	AKR/J, C3H/HeJ, C57BL/6J, DBA/2J
	c	154bp	SPRET/EiJ
	d	158bp	CAST/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24