D4Mit1 Primer Detail MGI Mouse MGI:700340

D4Mit1 Primer Detail

Name

D4Mit1
Primer 1 Sequence

ATGATGTACACTTAGGCATTGCA
Primer 2 Sequence

AGAAATATGGCAAGCAAAATGG
ID

MGI:700340
Product Size

119
Other IDs

D4Mit1 (BROAD)
Note

MIT assay: A73
Additional information: MIT STS Marker Data Files

D4Mit1

DNA segment, Chr 4, Massachusetts Institute of Technology 1

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D4Mit1	m	110bp	MOLF/EiJ
Not Specified	D4Mit1	s	120bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit1	a	91bp	CAST/EiJ
	b	110bp	AKR/J, BALB/cJ, LP/J, NOD/MrkTac
	c	112bp	A/J
	d	118bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt, SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit1	c	168bp	CBA/CaOlaHsd
	D4Mit1	s	175bp	SWR/OlaHsd

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24