About   Help   FAQ
D5Mit30 Primer Detail
Primers
  • Name
    D5Mit30
  • Primer 1 Sequence
    TCATTTTTACAAATTTTGGTGGG
  • Primer 2 Sequence
    AAGAACACCCAAGGTTGCC
  • ID
    MGI:700347
  • Product Size
    134
  • Other IDs
    D5Mit30 (BROAD)
  • Note
    MIT assay: D582
    Additional information: MIT STS Marker Data Files
Genes
D5Mit30 DNA segment, Chr 5, Massachusetts Institute of Technology 30
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit30 a 108bp SPRET/EiJ
b 138bp LP/J, NOD/MrkTac
c 144bp A/J, BALB/cJ
d 146bp CAST/EiJ
e 148bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
f 156bp NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D5Mit30 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit30 c 243bp CBA/CaOlaHsd
s 231bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory