D7Mit68 Primer Detail MGI Mouse MGI:700348

D7Mit68 Primer Detail

Name

D7Mit68
Primer 1 Sequence

CTCCCACACAGGGTCTTTGT
Primer 2 Sequence

GATACCCAAAGTACACCTCTGTCA
ID

MGI:700348
Product Size

184
Other IDs

D7Mit68 (BROAD)
Note

MIT assay: B447
Additional information: MIT STS Marker Data Files

D7Mit68

DNA segment, Chr 7, Massachusetts Institute of Technology 68

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit68	a	94bp	AKR/J, BALB/cJ, CAST/EiJ
	b	180bp	A/J
	c	188bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	d	340bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D7Mit68	a	188bp	129/SvW, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	b	180bp	A.CA/W
	c	94bp	AKR/W, BALB/cW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24