D4Mit172 Primer Detail MGI Mouse MGI:700367

D4Mit172 Primer Detail

Name

D4Mit172
Primer 1 Sequence

TGCAGGTAGGGGCTCAAG
Primer 2 Sequence

AAGCAGATCTGGCTTCCTCA
ID

MGI:700367
Product Size

131
Other IDs

D4Mit172 (BROAD)
Note

MIT assay: MTH149
Additional information: MIT STS Marker Data Files

D4Mit172

DNA segment, Chr 4, Massachusetts Institute of Technology 172

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit172	a	121bp	CAST/EiJ
	b	123bp	A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	137bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J
	d	161bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit172	a	137bp	129/SvW, BALB/cW, C57BL/6W, C57BL/10W
	D4Mit172	b	123bp	A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24