About   Help   FAQ
D6Mit223 Primer Detail
Primers
  • Name
    D6Mit223
  • Primer 1 Sequence
    ACATTGGTAGTAGACTTGATATTTCCA
  • Primer 2 Sequence
    TTACATGCTTGAGTGCTGGC
  • ID
    MGI:700371
  • Product Size
    123
  • Other IDs
    D6Mit223 (BROAD)
  • Note
    MIT assay: MT3249
    Additional information: MIT STS Marker Data Files
Genes
D6Mit223 DNA segment, Chr 6, Massachusetts Institute of Technology 223
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit223 a 102bp A/J
b 104bp AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
c 118bp SPRET/EiJ
d 126bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J
e 128bp LP/J
f 150bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D6Mit223 c 124bp CBA/CaOlaHsd
s 102bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D6Mit223 a larger 129P3/J
s smaller SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory