D6Mit228 Primer Detail MGI Mouse MGI:700376

D6Mit228 Primer Detail

Name

D6Mit228
Primer 1 Sequence

GTTCCCAACAAGGTGGCTAA
Primer 2 Sequence

GAGCAGTATGCGGCAGATTT
ID

MGI:700376
Product Size

105
Other IDs

D6Mit228 (BROAD)
Note

MIT assay: MT3438
Additional information: MIT STS Marker Data Files

D6Mit228

DNA segment, Chr 6, Massachusetts Institute of Technology 228

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit228	a	100bp	CAST/EiJ
	b	108bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	c	129bp	AKR/J, BALB/cJ, NON/ShiLt
	d	139bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit228	a	129bp	AKR/W, BALB/cW
	D6Mit228	b	108bp	129/SvW, A.CA/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24