D18Mit75 Primer Detail MGI Mouse MGI:700421

D18Mit75 Primer Detail

Name

D18Mit75
Primer 1 Sequence

TGAAACTCATTTAGATACATACACACA
Primer 2 Sequence

TTCAGCAGTTGGATGCAGAC
ID

MGI:700421
Product Size

218
Other IDs

D18Mit75 (BROAD)
Note

MIT assay: MPC1192
Additional information: MIT STS Marker Data Files

DNA segment, Chr 8, Massachusetts Institute of Technology 1004

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit1004	m	258bp	MOLF/EiJ
Not Specified	D8Mit1004	s	238bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit1004	a	114bp	CAST/EiJ
	b	118bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	128bp	SPRET/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24