D8Mit353 Primer Detail MGI Mouse MGI:700431

D8Mit353 Primer Detail

Name

D8Mit353
Primer 1 Sequence

TCTGGCTTGTAGTATCTGTATTCACA
Primer 2 Sequence

ATGAAGGTGTGTGTGTATATATGTGC
ID

MGI:700431
Product Size

115
Other IDs

D8Mit353 (BROAD)
Note

MIT assay: MTH2132
Additional information: MIT STS Marker Data Files

D8Mit353

DNA segment, Chr 8, Massachusetts Institute of Technology 353

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D8Mit353	a	116bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv, CD-1
Not Specified	D8Mit353	b	122bp	129X1/SvJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit353	a	90bp	AKR/J, NOD/MrkTac, SPRET/EiJ
	b	108bp	NON/ShiLt
	c	116bp	A/J, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
	d	122bp	CAST/EiJ
	e	124bp	BALB/cJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24