D1Mit155 Primer Detail MGI Mouse MGI:700448

D1Mit155 Primer Detail

Name

D1Mit155
Primer 1 Sequence

ATGCATGCATGCACACGT
Primer 2 Sequence

ACCGTGAAATGTTCACCCAT
ID

MGI:700448
Product Size

252
Other IDs

D1Mit155 (BROAD)
Note

MIT assay: MPC1521
Additional information: MIT STS Marker Data Files

D1Mit155

DNA segment, Chr 1, Massachusetts Institute of Technology 155

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit155	b	larger	C57BL/6J
	D1Mit155	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit155	a	214bp	NON/ShiLt
	b	216bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J
	c	218bp	NOD/MrkTac
	d	228bp	SPRET/EiJ
	e	252bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit155	l	larger	LG/J
	D1Mit155	s	smaller	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit155	c	217bp	CBA/CaOlaHsd
	D1Mit155	s	214bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit155	a	252bp	C57BL/6W, C57BL/10W
	D1Mit155	b	216bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13