D18Mit19 Primer Detail MGI Mouse MGI:700455

D18Mit19 Primer Detail

Name

D18Mit19
Primer 1 Sequence

ATTGGGTGTTCAGGTGCAG
Primer 2 Sequence

ATGCACAATAGCTCATAGCTTCT
ID

MGI:700455
Product Size

150
Other IDs

D18Mit19 (BROAD)
Note

MIT assay: A685
Additional information: MIT STS Marker Data Files

D18Mit19

DNA segment, Chr 18, Massachusetts Institute of Technology 19

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit19	a	156bp	129X1/Sv
Not Specified	D18Mit19	f	154, 156bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit19	c	160bp	C3HeB/FeJLe
	D18Mit19	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit19	a	138bp	AKR/J, LP/J
	b	140bp	CAST/EiJ
	c	152bp	SPRET/EiJ
	d	154bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	e	156bp	BALB/cJ
	f	158bp	A/J
	g	160bp	C3H/HeJ, DBA/2J, NON/ShiLt

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D18Mit19	c	larger	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit19	c	158bp	CBA/CaOlaHsd
	D18Mit19	s	156bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24