D18Mit16 Primer Detail MGI Mouse MGI:700458

D18Mit16 Primer Detail

Name

D18Mit16
Primer 1 Sequence

TTCCCTTTGGAGACTGTGCT
Primer 2 Sequence

TGGAATTACAGGGCTTCCTG
ID

MGI:700458
Product Size

207
Other IDs

D18Mit16 (BROAD)
Note

MIT assay: A35
Additional information: MIT STS Marker Data Files

D18Mit16

DNA segment, Chr 18, Massachusetts Institute of Technology 16

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit16	a	largest	C57BL/6, DBA/2
Not Specified	D18Mit16	b	smaller	JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit16	a	197bp	SPRET/EiJ
	b	199bp	CAST/EiJ
	c	206bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24