About   Help   FAQ
D18Mit17 Primer Detail
Primers
  • Name
    D18Mit17
  • Primer 1 Sequence
    TCAGGCAGATTCCAAGCAG
  • Primer 2 Sequence
    CTGTGGGTAGCCCAAGTCAT
  • ID
    MGI:700459
  • Product Size
    187
  • Other IDs
    D18Mit17 (BROAD)
  • Note
    MIT assay: d118
    Additional information: MIT STS Marker Data Files
Genes
D18Mit17 DNA segment, Chr 18, Massachusetts Institute of Technology 17
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit17 a 188bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 201bp CAST/EiJ
c 209bp SPRET/EiJ
d 211bp B6.Cg-Lepob/+
e 213bp C57BL/6J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D18Mit17 l smaller LG/J
s larger SM/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/19/2024
MGI 6.24 		The Jackson Laboratory