D2Mit493 Primer Detail MGI Mouse MGI:700482

D2Mit493 Primer Detail

Name

D2Mit493
Primer 1 Sequence

GTCTCTACCTGAGTTTCCATCACA
Primer 2 Sequence

TCCCGAGTTGTCCCTCTATG
ID

MGI:700482
Product Size

110
Other IDs

D2Mit493 (BROAD)
Note

MIT assay: MTH2822
Additional information: MIT STS Marker Data Files

D2Mit493

DNA Segment, Chr 2 Massachusetts Institute of Technology 493

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit493	a	97bp	A/J, DBA/2J, NOD/MrkTac, SPRET/EiJ
	b	109bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	c	123bp	CAST/EiJ
	d	125bp	LP/J, NON/ShiLt
	e	127bp	BALB/cJ, C3H/HeJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D2Mit493	a	111bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10
	c	127bp	129P3/J, BALB/cJ, SJL/J
	d	97bp	A/JOlaHsd, DBA/2J, JF1, PWB
	h	129bp	C3H/HeJ

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24