D15Mit171 Primer Detail MGI Mouse MGI:700508

D15Mit171 Primer Detail

Name

D15Mit171
Primer 1 Sequence

CCCATCAGTCCAAGAGAGATG
Primer 2 Sequence

AGGTGTACAGAAGTTCAGAAACAGC
ID

MGI:700508
Product Size

133
Other IDs

D15Mit171 (BROAD)
Note

MIT assay: MT565
Additional information: MIT STS Marker Data Files

DNA segment, Chr 15, Massachusetts Institute of Technology 171

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit171	a	115bp	SPRET/EiJ
	b	121bp	DBA/2J, NON/ShiLt
	c	133bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	139bp	AKR/J, BALB/cJ
	e	141bp	A/J, C3H/HeJ, LP/J, NOD/MrkTac
	f	143bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D15Mit171	b	130bp	C57BL/6JOlaHsd, C57BL/10
	c	138bp	AKR/OlaHsd, BALB/cJ
	d	118bp	DBA/2J
	j	136bp	129P3/J, JF1
	p	84bp	PWB
	w	140bp	A/JOlaHsd, C3H/HeJ, SJL/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24