About   Help   FAQ
D15Mit171 Primer Detail
Primers
  • Name
    D15Mit171
  • Primer 1 Sequence
    CCCATCAGTCCAAGAGAGATG
  • Primer 2 Sequence
    AGGTGTACAGAAGTTCAGAAACAGC
  • ID
    MGI:700508
  • Product Size
    133
  • Other IDs
    D15Mit171 (BROAD)
  • Note
    MIT assay: MT565
    Additional information: MIT STS Marker Data Files
Genes
D15Mit171 DNA segment, Chr 15, Massachusetts Institute of Technology 171
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit171 a 115bp SPRET/EiJ
b 121bp DBA/2J, NON/ShiLt
c 133bp B6.Cg-Lepob/+, C57BL/6J
d 139bp AKR/J, BALB/cJ
e 141bp A/J, C3H/HeJ, LP/J, NOD/MrkTac
f 143bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D15Mit171 b 130bp C57BL/6JOlaHsd, C57BL/10
c 138bp AKR/OlaHsd, BALB/cJ
d 118bp DBA/2J
j 136bp 129P3/J, JF1
p 84bp PWB
w 140bp A/JOlaHsd, C3H/HeJ, SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory