About   Help   FAQ
D3Mit10 Primer Detail
Primers
  • Name
    D3Mit10
  • Primer 1 Sequence
    CTGGCTTGGTGGAAGTCCT
  • Primer 2 Sequence
    CCTAAGCCAGCTACCACCAC
  • ID
    MGI:700546
  • Product Size
    142
  • Other IDs
    D3Mit10 (BROAD)
  • Note
    MIT assay: A34
    Additional information: MIT STS Marker Data Files
Genes
D3Mit10 DNA segment, Chr 3, Massachusetts Institute of Technology 10
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D3Mit10 c smaller C3HeB/FeJLe
f larger FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D3Mit10 m 140bp MOLF/EiJ
s 160bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit10 a 119bp NOD/MrkTac
b 129bp AKR/J, SPRET/EiJ
c 131bp A/J, BALB/cJ
d 133bp NON/ShiLt
e 135bp LP/J
f 138bp DBA/2J
g 142bp B6.Cg-Lepob/+, C57BL/6J
h 156bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D3Mit10 l smaller LG/J
s larger SM/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory