About   Help   FAQ
D11Mit149 Primer Detail
Primers
  • Name
    D11Mit149
  • Primer 1 Sequence
    AGACGGATGATCTCTGCCC
  • Primer 2 Sequence
    TTTGAATTTTATCCTTTGCAAGC
  • ID
    MGI:700565
  • Product Size
    144
  • Other IDs
    D11Mit149 (BROAD)
  • Note
    MIT assay: MT1200
    Additional information: MIT STS Marker Data Files
Genes
D9Mit1003 DNA segment, Chr 9, Massachusetts Institute of Technology 1003
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit1003 a 135bp LP/J
b 139bp SPRET/EiJ
c 143bp NON/ShiLt
d 145bp AKR/J, C57BL/6J, NOD/MrkTac
e 147bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, DBA/2J
f 161bp CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D9Mit1003 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D9Mit1003 c 146bp CBA/CaOlaHsd
s 134bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory

Building initial tooltip...