About   Help   FAQ
D8Mit3 Primer Detail
Primers
  • Name
    D8Mit3
  • Primer 1 Sequence
    TCCCATTCTCGCATAAGTCC
  • Primer 2 Sequence
    GATGGGAAGACAGGGTAGCA
  • ID
    MGI:700622
  • Product Size
    172
  • Other IDs
    D8Mit3 (BROAD)
  • Note
    MIT assay: M195
    Additional information: MIT STS Marker Data Files
Genes
D8Mit3 DNA segment, Chr 8, Massachusetts Institute of Technology 3
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit3 b 0.178kb B10.D2-H2d, C57BL/6J
c 0.187kb B10.BR-H2k, BALB.K-H2k, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit3 a largest C57BL/6, DBA/2
b smaller JF1, MSM/Ms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit3 m 192bp MOLF/EiJ
s 185bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit3 a 160bp SPRET/EiJ
b 178bp B6.Cg-Lepob/+, C57BL/6J
c 185bp CAST/EiJ
d 187bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory