About   Help   FAQ
D8Mit4 Primer Detail
Primers
  • Name
    D8Mit4
  • Primer 1 Sequence
    CCAACTCATCCCCAAAGGTA
  • Primer 2 Sequence
    GTATGTTCAAGGCTGGGCAT
  • ID
    MGI:700623
  • Product Size
    158
  • Other IDs
    D8Mit4 (BROAD)
  • Note
    MIT assay: M71
    Additional information: MIT STS Marker Data Files
Genes
D8Mit4 DNA segment, Chr 8, Massachusetts Institute of Technology 4
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D8Mit4 b smaller C57BL/6J
f larger FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit4 a largest DBA/2
b smaller C57BL/6, JF1, MSM/Ms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit4 a 157bp B6.Cg-Lepob/+, C57BL/6J
b 160bp LP/J
c 170bp SPRET/EiJ
d 191bp CAST/EiJ
e 195bp AKR/J, C3H/HeJ, DBA/2J, NON/ShiLt
f 200bp A/J, BALB/cJ, NOD/MrkTac
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D8Mit4 b 156bp 129P3/J, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, JF1
c 192bp A/JOlaHsd, BALB/cJ, SJL/J
d 188bp AKR/OlaHsd, DBA/2J
p 152bp PWB
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory