D3Mit21 Primer Detail MGI Mouse MGI:700635

D3Mit21 Primer Detail

Name

D3Mit21
Primer 1 Sequence

AAGCTCTACAGCGGAAGCAC
Primer 2 Sequence

CTGGGGAGTTTCAGGTTCCT
ID

MGI:700635
Product Size

132
Other IDs

D3Mit21 (BROAD)
Note

MIT assay: D31
Additional information: MIT STS Marker Data Files

D3Mit21

DNA segment, Chr 3, Massachusetts Institute of Technology 21

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D3Mit21	m	245bp	MOLF/EiJ
Not Specified	D3Mit21	s	286bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit21	a	208bp	SPRET/EiJ
	b	216bp	CAST/EiJ
	c	218bp	A/J, AKR/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
	d	236bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit21	a	236bp	BALB/cW, C57BL/6W, C57BL/10W
	D3Mit21	b	218bp	129/SvW, A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W, DBA/2W

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24