D10Mit80 Primer Detail MGI Mouse MGI:700662

D10Mit80 Primer Detail

Name

D10Mit80
Primer 1 Sequence

CAAAAAAAACCCTGATTCTACCA
Primer 2 Sequence

GTGTGCATATGGCAGTAACTTTG
ID

MGI:700662
Product Size

154
Other IDs

D10Mit80 (BROAD)
Note

MIT assay: MPC104
Additional information: MIT STS Marker Data Files

D10Mit80

DNA segment, Chr 10, Massachusetts Institute of Technology 80

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit80	a	164bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	152bp	129X1/SvJ
		c	144, 158bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D10Mit80	b	largest	C57BL/6J
	c	144bp	C3HeB/FeJLe
	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit80	a	144bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
	b	150bp	NON/ShiLt
	c	158bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	164bp	DBA/2J
	e	172bp	CAST/EiJ, SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D10Mit80	a	164bp	BN/aW, DBA/2W
	b	158bp	129/SvW, C57BL/6W, C57BL/10W
	c	144bp	A.CA/W, AKR/W, BALB/cW, C3H/W, CBA/W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit80	c	lower	CBA/Kw
	D10Mit80	e	upper	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24