D11Mit74 Primer Detail MGI Mouse MGI:700676

D11Mit74 Primer Detail

Name

D11Mit74
Primer 1 Sequence

AAAACCTGAGTTCGACCCCT
Primer 2 Sequence

ATAAAGCCTCATCTACATGGGC
ID

MGI:700676
Product Size

218
Other IDs

D11Mit74 (BROAD)
Note

MIT assay: MPC1407
Additional information: MIT STS Marker Data Files

D11Mit74

DNA segment, Chr 11, Massachusetts Institute of Technology 74

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit74	a	214bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	226bp	129X1/SvJ
		c	214, 226, 232bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit74	a	210bp	LP/J
	b	214bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	c	216bp	C3H/HeJ
	d	226bp	BALB/cJ
	e	230bp	AKR/J, NOD/MrkTac
	f	232bp	A/J, NON/ShiLt
	g	238bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24