DXMit81 Primer Detail MGI Mouse MGI:700683

DXMit81 Primer Detail

Name

DXMit81
Primer 1 Sequence

GAGGAGCATCAACCTTCTCG
Primer 2 Sequence

GAGGTGGGGAGAAACAGAGG
ID

MGI:700683
Product Size

200
Other IDs

DXMit81 (BROAD)
Note

MIT assay: MT1219
Additional information: MIT STS Marker Data Files

DXMit81

DNA segment, Chr X, Massachusetts Institute of Technology 81

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit81	a	181bp	SPRET/EiJ
	b	191bp	AKR/J, BALB/cJ, CAST/EiJ, DBA/2J, LP/J, NOD/MrkTac
	c	193bp	C3H/HeJ, NON/ShiLt
	d	199bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
DXMit81	a	199bp	AKR/OlaHsd, C3H/HeJ
	d	197bp	129P3/J, A/JOlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
	j	183bp	JF1
	p	181bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24