D3Mit116 Primer Detail MGI Mouse MGI:700686

D3Mit116 Primer Detail

Name

D3Mit116
Primer 1 Sequence

TCACTGCCCATCTTTGTAACC
Primer 2 Sequence

CCCAGAGACCCGGAATAGAA
ID

MGI:700686
Product Size

259
Other IDs

D3Mit116 (BROAD)
Note

MIT assay: MPC2319
Additional information: MIT STS Marker Data Files

D3Mit116

DNA segment, Chr 3, Massachusetts Institute of Technology 116

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit116	b	smaller	C57BL/6J
	D3Mit116	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit116	a	263bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	b	275bp	A/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	c	287bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24