D15Mit76 Primer Detail MGI Mouse MGI:700693

D15Mit76 Primer Detail

Name

D15Mit76
Primer 1 Sequence

ACAACACTGCCTTCTTTGCC
Primer 2 Sequence

GACAGGCATTTTTGGACACA
ID

MGI:700693
Product Size

261
Other IDs

D15Mit76 (BROAD)
Note

MIT assay: MPC1910
Additional information: MIT STS Marker Data Files

D15Mit76

DNA segment, Chr 15, Massachusetts Institute of Technology 76

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit76	b	smaller	C57BL/6J
	D15Mit76	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit76	a	222bp	CAST/EiJ
	b	250bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J
	c	252bp	A/J, NOD/MrkTac
	d	254bp	AKR/J, C3H/HeJ, DBA/2J
	e	256bp	NON/ShiLt

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24