About   Help   FAQ
D12Mit4 Primer Detail
Primers
  • Name
    D12Mit4
  • Primer 1 Sequence
    ACATCCCCAGCTCTTGTTTG
  • Primer 2 Sequence
    AAACCAAACCAAAGAAGCTTAGG
  • ID
    MGI:700703
  • Product Size
    201
  • Other IDs
    D12Mit4 (BROAD)
  • Note
    MIT assay: A64
    Additional information: MIT STS Marker Data Files
Genes
D12Mit4 DNA segment, Chr 12, Massachusetts Institute of Technology 4
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Mit4 b smaller C57BL/6J
f larger FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D12Mit4 a largest JF1, MSM/Ms
b smaller C57BL/6, DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit4 a 182bp AKR/J, NON/ShiLt
b 194bp BALB/cJ
c 197bp NOD/MrkTac
d 201bp B6.Cg-Lepob/+
e 202bp C57BL/6J
f 204bp A/J, C3H/HeJ, DBA/2J, LP/J
g 212bp SPRET/EiJ
h 269bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D12Mit4 a 178bp 129P3/J, AKR/OlaHsd, SJL/J
b 198bp C57BL/6JOlaHsd
c 188bp BALB/cJ
d 200bp A/JOlaHsd, C3H/HeJ, C57BL/10, DBA/2J
j 216bp JF1
p 212bp PWB
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D12Mit4 c larger CBA/Kw
e smaller KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory