About   Help   FAQ
D12Mit6 Primer Detail
Primers
  • Name
    D12Mit6
  • Primer 1 Sequence
    ATGCTCGACATCAACCTTGG
  • Primer 2 Sequence
    TATCTGTGTGGCTGGAACGA
  • ID
    MGI:700709
  • Product Size
    105
  • Other IDs
    D12Mit6 (BROAD)
  • Note
    MIT assay: L16
    Additional information: MIT STS Marker Data Files
Genes
D12Mit6 DNA segment, Chr 12, Massachusetts Institute of Technology 6
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D12Mit6 a largest MSM/Ms
b smaller JF1
c smallest C57BL/6, DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit6 a 106bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
b 109bp SPRET/EiJ
c 117bp LP/J
d 123bp CAST/EiJ
J:57749 Hansen GM, et al., Genome Res. 2000 Feb;10(2):237-43
Endonuclease Gene Allele Fragments Strains
D12Mit6 l 0.12kb SB/LeJ
s 0.11kb M. spretus
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D12Mit6 l smaller LG/J
s larger SM/J
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57749 Hansen GM, et al., Genetic profile of insertion mutations in mouse leukemias and lymphomas. Genome Res. 2000 Feb;10(2):237-43
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory