D12Mit6 Primer Detail MGI Mouse MGI:700709

D12Mit6 Primer Detail

Name

D12Mit6
Primer 1 Sequence

ATGCTCGACATCAACCTTGG
Primer 2 Sequence

TATCTGTGTGGCTGGAACGA
ID

MGI:700709
Product Size

105
Other IDs

D12Mit6 (BROAD)
Note

MIT assay: L16
Additional information: MIT STS Marker Data Files

D12Mit6

DNA segment, Chr 12, Massachusetts Institute of Technology 6

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit6	a	largest	MSM/Ms
		b	smaller	JF1
		c	smallest	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit6	a	106bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	b	109bp	SPRET/EiJ
	c	117bp	LP/J
	d	123bp	CAST/EiJ

J:57749 Hansen GM, et al., Genome Res. 2000 Feb;10(2):237-43

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit6	l	0.12kb	SB/LeJ
	D12Mit6	s	0.11kb	M. spretus

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit6	l	smaller	LG/J
	D12Mit6	s	larger	SM/J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57749 Hansen GM, et al., Genetic profile of insertion mutations in mouse leukemias and lymphomas. Genome Res. 2000 Feb;10(2):237-43

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24