D7Mit159 Primer Detail MGI Mouse MGI:700710

D7Mit159 Primer Detail

Name

D7Mit159
Primer 1 Sequence

ATAGCAAAACAAAACAAAACTCTGG
Primer 2 Sequence

GTAACTGGCACGCAGAGACA
ID

MGI:700710
Product Size

148
Other IDs

D7Mit159 (BROAD)
Note

MIT assay: MT941
Additional information: MIT STS Marker Data Files

D7Mit159

DNA segment, Chr 7, Massachusetts Institute of Technology 159

J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit159	a	150bp	129S/SvEv, 129T1/Sv-Dnd1^Ter, 129X1/Sv, C3HeB/FeJ
		b	160bp	129P1/ReJ, 129P2/Ola, 129P3/J, 129P4/RrRkJ, 129X1/SvJ
		c	158bp	C57BL/6J

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit159	a	150bp	129X1/Sv, CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit159	a	146bp	BALB/cJ, DBA/2J
	b	148bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	150bp	AKR/J, C3H/HeJ, LP/J, NOD/MrkTac
	d	162bp	SPRET/EiJ
	e	168bp	CAST/EiJ
	f	172bp	A/J, NON/ShiLt

J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24