D7Mit152 Primer Detail MGI Mouse MGI:700717

D7Mit152 Primer Detail

Name

D7Mit152
Primer 1 Sequence

GCCTAGCACACGCCAAAG
Primer 2 Sequence

CCTTGTGCATGGTTGCTATG
ID

MGI:700717
Product Size

129
Other IDs

D7Mit152 (BROAD)
Note

MIT assay: MT684
Additional information: MIT STS Marker Data Files

D7Mit152

DNA segment, Chr 7, Massachusetts Institute of Technology 152

J:43450 Haddad R, et al., Cancer Res. 1997 Oct 15;57(20):4615-23

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit152	a	larger	129/Sv
		b	absent	C57BL/10
		c	smaller	C3H

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit152	a	109bp	CAST/EiJ
	b	123bp	A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
	c	127bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	133bp	BALB/cJ, LP/J

J:43450 Haddad R, et al., Genomic imprinting and Igf2 influence liver tumorigenesis and loss of heterozygosity in SV40 T antigen transgenic mice. Cancer Res. 1997 Oct 15;57(20):4615-23

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24