D6Mit268 Primer Detail MGI Mouse MGI:700752

D6Mit268 Primer Detail

Name

D6Mit268
Primer 1 Sequence

AGTCAGAATATGGCAAGTCAGTG
Primer 2 Sequence

TTTCAGAGTCTTTCTTTCAGTATCTCC
ID

MGI:700752
Product Size

122
Other IDs

D6Mit268 (BROAD)
Note

MIT assay: MT4993
Additional information: MIT STS Marker Data Files

D6Mit268

DNA segment, Chr 6, Massachusetts Institute of Technology 268

J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit268	b	0.123kb	B10.BR-H2^k, B10.D2-H2^d, BALB/cByJ, C57BL/6
Not Specified	D6Mit268	c	0.127kb	BALB.K-H2^k, BALB/cAnNCr, BALB/cJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit268	a	110bp	C3H/HeJ, CAST/EiJ, SPRET/EiJ
	b	112bp	LP/J
	c	123bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	127bp	A/J, AKR/J, BALB/cJ, DBA/2J, NOD/MrkTac, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D6Mit268	a	127bp	A.CA/W, AKR/W, BALB/cW, DBA/2W
	b	123bp	C57BL/6W, C57BL/10W
	c	110bp	129/SvW, BN/aW, C3H/W, CBA/W

J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24