D14Mit8 Primer Detail MGI Mouse MGI:700788

D14Mit8 Primer Detail

Name

D14Mit8
Primer 1 Sequence

TCACAGGTGCTCTCAGTCATG
Primer 2 Sequence

GCAAATACTTCCCTTCTTGGG
ID

MGI:700788
Product Size

204
Other IDs

D14Mit8 (BROAD)
Note

MIT assay: A44
Additional information: MIT STS Marker Data Files

D14Mit8

DNA segment, Chr 14, Massachusetts Institute of Technology 8

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit8	a	Largest	C57BL/6, DBA/2
Not Specified	D14Mit8	b	smaller	JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit8	a	194bp	LP/J
	b	202bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
	c	204bp	NON/ShiLt
	d	209bp	CAST/EiJ, SPRET/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24