D18Mit64 Primer Detail MGI Mouse MGI:700817

D18Mit64 Primer Detail

Name

D18Mit64
Primer 1 Sequence

TCAGATTCACTGCTAAGTCTTTTC
Primer 2 Sequence

AGCAAGAAAAGCAGGTGAGG
ID

MGI:700817
Product Size

152
Other IDs

D18Mit64 (BROAD)
Note

MIT assay: MPC277
Additional information: MIT STS Marker Data Files

D18Mit64

DNA segment, Chr 18, Massachusetts Institute of Technology 64

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit64	a	172bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	166bp	129X1/SvJ
		c	152bp	CD-1

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit64	m	190bp	MOLF/EiJ
Not Specified	D18Mit64	s	183bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit64	a	152bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	b	154bp	CAST/EiJ
	c	172bp	AKR/J, BALB/cJ, C3H/HeJ, LP/J, SPRET/EiJ

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit64	a	larger	129P3/J
	D18Mit64	s	smaller	SJL/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit64	a	172bp	129/SvW, AKR/W, BALB/cW, C3H/W, CBA/W
	D18Mit64	b	152bp	A.CA/W, BN/aW, C57BL/6W, C57BL/10W, DBA/2W

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24