About   Help   FAQ
D5Mit113 Primer Detail
Primers
  • Name
    D5Mit113
  • Primer 1 Sequence
    ACAGTATTTTCTTTTTCCAAGTGTG
  • Primer 2 Sequence
    CAAAGACTCTAGGTGTGACCCC
  • ID
    MGI:700846
  • Product Size
    105
  • Other IDs
    D5Mit113 (BROAD)
  • Note
    MIT assay: D899
    Additional information: MIT STS Marker Data Files
Genes
D5Mit113 DNA segment, Chr 5, Massachusetts Institute of Technology 113
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit113 a 70bp SPRET/EiJ
b 76bp A/J
c 98bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
d 100bp CAST/EiJ
e 102bp LP/J
f 104bp AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac
g 112bp NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit113 c 103bp CBA/CaOlaHsd
s 100bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit113 a larger 129P3/J
s smaller SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory